Lenght of a PCR product
Exon 6 of RUNX2 gene (coding for runt-related transcription factor 2) has following sequence (in 5´->3´ direction):
>RUNX2_exon6
GGCACAGACAGAAGCTTGATGACTCTAAACCTAGTTTGTTCTCTGACCG
CCTCAGTGATTTAGGGCGCATTCCTCATCCCAGTATGAGAGTAGGTGTC
CCGCCTCAGAACCCACGGCCCTCCCTGAACTCTGCACCAAGTCCTTTTA
ATCCACAAGGACAGAGTCAGATTACAG
We plan to perform PCR with primers (in 5´- 3´ direction):
| RUNX2_exon6_forward |
CGCATTCCTCATCCCAGTAT |
| RUNX2_exon6_reverse |
AAGGACTTGGTGCAGAGTTCA |
- What is the expected length of this PCR product?
- What methods can be used to check the amplification and how to measure the actual product length?
Nápověda
- For text search it is possibe to use Notepad or any other more sophisticated text editor. (typical keyboard shortcut Ctrl+F); it is important to keep in mind the double stranded antiparallel DNA structure
- A tool for generating complementary strands
If you use this software, the default setting returns "reverse complement", which is the complementary strand in 5´-> 3´ orientation. It should be mentioned that in various databases, DNA is typically in 5´->3´ orientation without explicitly mentioning it. If you need 3´->5´ orientation, use the option "complement".